ID: 976775609_976775617

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 976775609 976775617
Species Human (GRCh38) Human (GRCh38)
Location 4:88702926-88702948 4:88702963-88702985
Sequence CCACAATCTGCAGCAACCTGCCC TTATCTGCAATAAGCAGCCCAGG
Strand - +
Off-target summary {0: 3, 1: 9, 2: 39, 3: 76, 4: 294} {0: 1, 1: 2, 2: 13, 3: 39, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!