ID: 976775997_976776002

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 976775997 976776002
Species Human (GRCh38) Human (GRCh38)
Location 4:88706794-88706816 4:88706813-88706835
Sequence CCAGTCTGCAGATTGTCATCCAG CCAGTCCACAGCCAGCGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 232} {0: 1, 1: 0, 2: 2, 3: 31, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!