ID: 976811566_976811571

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 976811566 976811571
Species Human (GRCh38) Human (GRCh38)
Location 4:89105642-89105664 4:89105692-89105714
Sequence CCCAGATAGATGCTCTGGCTCAA AGAGCCTTTTGTGTTTGATTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 192} {0: 4, 1: 9, 2: 20, 3: 33, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!