ID: 976888044_976888053

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 976888044 976888053
Species Human (GRCh38) Human (GRCh38)
Location 4:90009612-90009634 4:90009661-90009683
Sequence CCAAGTATCTGCTGTCTTCAAGA ATAAACTTAAGGTAAAGGGGTGG
Strand - +
Off-target summary No data {0: 188, 1: 446, 2: 399, 3: 274, 4: 531}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!