ID: 976899120_976899122

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 976899120 976899122
Species Human (GRCh38) Human (GRCh38)
Location 4:90152317-90152339 4:90152344-90152366
Sequence CCTTGATTGGTGTGTGTAGGTTA TTTGCCCTTAACCTGAGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100} {0: 1, 1: 0, 2: 0, 3: 17, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!