ID: 976921318_976921322

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 976921318 976921322
Species Human (GRCh38) Human (GRCh38)
Location 4:90447409-90447431 4:90447435-90447457
Sequence CCTTTCTGGCTGTTGAAATCAAA CAAAAATTCTCTGAAGGGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 268} {0: 1, 1: 0, 2: 1, 3: 43, 4: 491}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!