ID: 976929805_976929811

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 976929805 976929811
Species Human (GRCh38) Human (GRCh38)
Location 4:90551974-90551996 4:90552007-90552029
Sequence CCTTGATGTTGCATCCTCTGGAG CTGTGTCCCCACATGGAGAAAGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 87, 3: 586, 4: 1718}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!