ID: 977064839_977064847

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 977064839 977064847
Species Human (GRCh38) Human (GRCh38)
Location 4:92302499-92302521 4:92302552-92302574
Sequence CCACATTAAAGGACTGGACACTA CTTGAGATGGTGAAGGAGAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 38, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!