ID: 977122140_977122144

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 977122140 977122144
Species Human (GRCh38) Human (GRCh38)
Location 4:93115611-93115633 4:93115651-93115673
Sequence CCTGAGACTGGGTAATTTATAAA GACTCACAGTTCCACAGGACTGG
Strand - +
Off-target summary {0: 6401, 1: 13084, 2: 14111, 3: 11019, 4: 7181} {0: 14, 1: 381, 2: 3819, 3: 7199, 4: 8863}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!