|
Left Crispr |
Right Crispr |
Crispr ID |
977122140 |
977122144 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:93115611-93115633
|
4:93115651-93115673
|
Sequence |
CCTGAGACTGGGTAATTTATAAA |
GACTCACAGTTCCACAGGACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 6401, 1: 13084, 2: 14111, 3: 11019, 4: 7181} |
{0: 14, 1: 381, 2: 3819, 3: 7199, 4: 8863} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|