ID: 977155692_977155696

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 977155692 977155696
Species Human (GRCh38) Human (GRCh38)
Location 4:93570175-93570197 4:93570196-93570218
Sequence CCACAGTCACACAAGGTCACTCA CAGTAGCCAGTGGTGGAGCTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!