ID: 977295293_977295299

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 977295293 977295299
Species Human (GRCh38) Human (GRCh38)
Location 4:95202781-95202803 4:95202821-95202843
Sequence CCAGCGAGGAGCAGCACAGGGGC GAGGCGCTTCGCAGCCGCTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 242} {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!