ID: 977313386_977313392

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 977313386 977313392
Species Human (GRCh38) Human (GRCh38)
Location 4:95414219-95414241 4:95414270-95414292
Sequence CCCCCACAAAAAATAGGTCTGGT GATAAGAAAAAAGAAGATGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 145} {0: 1, 1: 0, 2: 7, 3: 156, 4: 1612}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!