ID: 977314361_977314363

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 977314361 977314363
Species Human (GRCh38) Human (GRCh38)
Location 4:95426666-95426688 4:95426680-95426702
Sequence CCTCATTGTTGATACACAGAACG CACAGAACGTTTTAGTGGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 99} {0: 1, 1: 1, 2: 8, 3: 95, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!