ID: 977323676_977323684

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 977323676 977323684
Species Human (GRCh38) Human (GRCh38)
Location 4:95549163-95549185 4:95549215-95549237
Sequence CCAGCAGCAGGAGCAGCCGCAGC TCCGGGTCCCCTCGCCTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 130, 3: 360, 4: 1124} {0: 1, 1: 0, 2: 2, 3: 10, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!