ID: 977470747_977470754

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 977470747 977470754
Species Human (GRCh38) Human (GRCh38)
Location 4:97438475-97438497 4:97438504-97438526
Sequence CCTGCCGCAAGCTGAGGGAGCTG GACTTGGCCAGCCCAGAAAGGGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 4, 3: 27, 4: 212} {0: 5, 1: 927, 2: 490, 3: 329, 4: 444}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!