ID: 977556689_977556701

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 977556689 977556701
Species Human (GRCh38) Human (GRCh38)
Location 4:98494295-98494317 4:98494330-98494352
Sequence CCCCTGGGATCCAAGTAAATCCA TGGGGTAGCCTGGACAATGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133} {0: 1, 1: 0, 2: 1, 3: 8, 4: 239}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!