ID: 977753175_977753179

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 977753175 977753179
Species Human (GRCh38) Human (GRCh38)
Location 4:100633826-100633848 4:100633877-100633899
Sequence CCGAAGGACTGAGAACAAGGAGT ATGTCACAGCTGAAGCAGAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 20, 3: 154, 4: 643} {0: 1, 1: 1, 2: 8, 3: 46, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!