ID: 977763664_977763666

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 977763664 977763666
Species Human (GRCh38) Human (GRCh38)
Location 4:100771956-100771978 4:100772000-100772022
Sequence CCAGAAGTAAATCTACATATTGC GGTGCCAAGAACACACAATGAGG
Strand - +
Off-target summary No data {0: 63, 1: 229, 2: 809, 3: 1420, 4: 2138}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!