ID: 977763664_977763668

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 977763664 977763668
Species Human (GRCh38) Human (GRCh38)
Location 4:100771956-100771978 4:100772005-100772027
Sequence CCAGAAGTAAATCTACATATTGC CAAGAACACACAATGAGGAAAGG
Strand - +
Off-target summary No data {0: 14, 1: 142, 2: 488, 3: 1638, 4: 7484}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!