ID: 977771710_977771714

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 977771710 977771714
Species Human (GRCh38) Human (GRCh38)
Location 4:100868526-100868548 4:100868549-100868571
Sequence CCTTCCAGCTGCAGCATAGCAGG TGGATCTCAGATTGCTGCACTGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 13, 3: 40, 4: 296} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!