ID: 977827193_977827196

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 977827193 977827196
Species Human (GRCh38) Human (GRCh38)
Location 4:101547177-101547199 4:101547224-101547246
Sequence CCCTTAGCCATTAATATGGTGGA TGAACCAGTTTTCAAAGAACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 19, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!