ID: 977831834_977831837

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 977831834 977831837
Species Human (GRCh38) Human (GRCh38)
Location 4:101603328-101603350 4:101603359-101603381
Sequence CCATGTATATCAGTTACATACAT ACATATATAAAATAGTTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 210} {0: 1, 1: 0, 2: 5, 3: 61, 4: 466}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!