ID: 977867617_977867620

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 977867617 977867620
Species Human (GRCh38) Human (GRCh38)
Location 4:102048714-102048736 4:102048748-102048770
Sequence CCAACTGTTTTCCCATTGAAAGT AAGTGCACTAAGTTTAAGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 295} {0: 1, 1: 0, 2: 0, 3: 4, 4: 90}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!