ID: 977912844_977912851

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 977912844 977912851
Species Human (GRCh38) Human (GRCh38)
Location 4:102557831-102557853 4:102557882-102557904
Sequence CCCTTCACTTTCTCACAGCTGGC CCTTTTTACCAGATACTGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 227} {0: 1, 1: 0, 2: 1, 3: 8, 4: 115}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!