ID: 977928664_977928671

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 977928664 977928671
Species Human (GRCh38) Human (GRCh38)
Location 4:102729078-102729100 4:102729106-102729128
Sequence CCTGCTTGGCCTGCTGCAGGGCG CAGCTTGGACAGCTTGGCGTTGG
Strand - +
Off-target summary {0: 2, 1: 15, 2: 32, 3: 33, 4: 279} {0: 2, 1: 11, 2: 13, 3: 18, 4: 123}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!