|
Left Crispr |
Right Crispr |
Crispr ID |
977928666 |
977928671 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:102729087-102729109
|
4:102729106-102729128
|
Sequence |
CCTGCTGCAGGGCGGCCTCCAGC |
CAGCTTGGACAGCTTGGCGTTGG |
Strand |
- |
+ |
Off-target summary |
{0: 12, 1: 16, 2: 20, 3: 49, 4: 391} |
{0: 2, 1: 11, 2: 13, 3: 18, 4: 123} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|