ID: 977963869_977963876

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 977963869 977963876
Species Human (GRCh38) Human (GRCh38)
Location 4:103119746-103119768 4:103119765-103119787
Sequence CCCCCAAAACAGGTCAGATTCAG TCAGCCCATGGGATATCAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 212} {0: 1, 1: 0, 2: 1, 3: 7, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!