ID: 978273973_978273978

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 978273973 978273978
Species Human (GRCh38) Human (GRCh38)
Location 4:106926445-106926467 4:106926480-106926502
Sequence CCTTTCAGTTCCTGCCTATAAAA AACATTTCCAGAACAGTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 254} {0: 1, 1: 0, 2: 0, 3: 23, 4: 287}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!