ID: 978353353_978353356

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 978353353 978353356
Species Human (GRCh38) Human (GRCh38)
Location 4:107844033-107844055 4:107844060-107844082
Sequence CCTCTTTTTGCCAGGCACGGTGG CGCCTATAATCCCAGCACTTTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 33, 3: 262, 4: 1203} {0: 9370, 1: 149078, 2: 285159, 3: 214832, 4: 149190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!