ID: 978353353_978353359

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 978353353 978353359
Species Human (GRCh38) Human (GRCh38)
Location 4:107844033-107844055 4:107844064-107844086
Sequence CCTCTTTTTGCCAGGCACGGTGG TATAATCCCAGCACTTTGGGAGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 33, 3: 262, 4: 1203} {0: 26361, 1: 319744, 2: 258545, 3: 142388, 4: 133448}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!