|
Left Crispr |
Right Crispr |
Crispr ID |
978353353 |
978353359 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:107844033-107844055
|
4:107844064-107844086
|
Sequence |
CCTCTTTTTGCCAGGCACGGTGG |
TATAATCCCAGCACTTTGGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 2, 2: 33, 3: 262, 4: 1203} |
{0: 26361, 1: 319744, 2: 258545, 3: 142388, 4: 133448} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|