ID: 978415815_978415821

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 978415815 978415821
Species Human (GRCh38) Human (GRCh38)
Location 4:108474785-108474807 4:108474814-108474836
Sequence CCTAGTAGGAGGTGTTGGGTCAT CAGATCCTTCATGAACGGCTTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!