ID: 978503528_978503538

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 978503528 978503538
Species Human (GRCh38) Human (GRCh38)
Location 4:109433797-109433819 4:109433822-109433844
Sequence CCTCTCCGGCCCCGCCTTCCCTT CTCCGCCCACCTCCCTGAAGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 48, 4: 629} {0: 1, 1: 0, 2: 1, 3: 22, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!