ID: 978503632_978503647

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 978503632 978503647
Species Human (GRCh38) Human (GRCh38)
Location 4:109434087-109434109 4:109434122-109434144
Sequence CCGGGAAGGGCGTTCGGGGCCAG GGACGGGAGCGGGCGCGGTGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 131} {0: 1, 1: 0, 2: 1, 3: 59, 4: 471}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!