ID: 978529938_978529953

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 978529938 978529953
Species Human (GRCh38) Human (GRCh38)
Location 4:109703065-109703087 4:109703109-109703131
Sequence CCCCGGAGGACAAAGGCGGCAGG CGCTACTCGGGACCGCCAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 146} {0: 1, 1: 0, 2: 0, 3: 4, 4: 60}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!