ID: 978539466_978539470

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 978539466 978539470
Species Human (GRCh38) Human (GRCh38)
Location 4:109801525-109801547 4:109801545-109801567
Sequence CCCCTTTCTATAACTATAGAGCG GCGTACTAAGAGGCTGTTGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 66} {0: 1, 1: 1, 2: 0, 3: 1, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!