ID: 978569791_978569793

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 978569791 978569793
Species Human (GRCh38) Human (GRCh38)
Location 4:110124312-110124334 4:110124338-110124360
Sequence CCACTAATGATGGACTGGACAAA AATGTGGTATATATACACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 34, 3: 620, 4: 6379} {0: 542, 1: 5227, 2: 28767, 3: 16574, 4: 9981}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!