ID: 978572776_978572786

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 978572776 978572786
Species Human (GRCh38) Human (GRCh38)
Location 4:110157085-110157107 4:110157121-110157143
Sequence CCATCTGGGTCACTGCCCATTTG AAGGCCAAGAAGAAGGAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 307} {0: 1, 1: 0, 2: 14, 3: 158, 4: 1310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!