ID: 978761447_978761460

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 978761447 978761460
Species Human (GRCh38) Human (GRCh38)
Location 4:112358811-112358833 4:112358859-112358881
Sequence CCAAGCCAACTTTGCCACCTTCA TTCCGATGACTTTGCTGCCCTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 17, 4: 257} {0: 1, 1: 0, 2: 1, 3: 4, 4: 81}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!