ID: 978817599_978817603

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 978817599 978817603
Species Human (GRCh38) Human (GRCh38)
Location 4:112926880-112926902 4:112926919-112926941
Sequence CCTGAAACTGGGTAATTTATTAA GACTCACAGTTCCACAGGACTGG
Strand - +
Off-target summary {0: 14, 1: 752, 2: 9049, 3: 14839, 4: 14497} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!