ID: 978985376_978985382

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 978985376 978985382
Species Human (GRCh38) Human (GRCh38)
Location 4:115005688-115005710 4:115005736-115005758
Sequence CCTAGAGGTGGTGACCAAGAGAT AGTTAGCTGGATAAGATGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 124} {0: 1, 1: 0, 2: 8, 3: 138, 4: 2207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!