ID: 979205957_979205960

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 979205957 979205960
Species Human (GRCh38) Human (GRCh38)
Location 4:118038254-118038276 4:118038275-118038297
Sequence CCTTAAGTCATATAGGGCAGAAT ATAAACAGCAAACAGCAGTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 89} {0: 1, 1: 0, 2: 3, 3: 39, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!