|
Left Crispr |
Right Crispr |
Crispr ID |
979210401 |
979210405 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:118094074-118094096
|
4:118094114-118094136
|
Sequence |
CCTGAAGGCCTCACTTCTTAATA |
AAGTTTCAACATATGTATTGTGG |
Strand |
- |
+ |
Off-target summary |
{0: 1, 1: 16, 2: 132, 3: 597, 4: 1754} |
{0: 1, 1: 3, 2: 121, 3: 540, 4: 1833} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|