ID: 979210401_979210405

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 979210401 979210405
Species Human (GRCh38) Human (GRCh38)
Location 4:118094074-118094096 4:118094114-118094136
Sequence CCTGAAGGCCTCACTTCTTAATA AAGTTTCAACATATGTATTGTGG
Strand - +
Off-target summary {0: 1, 1: 16, 2: 132, 3: 597, 4: 1754} {0: 1, 1: 3, 2: 121, 3: 540, 4: 1833}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!