ID: 979230679_979230683

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 979230679 979230683
Species Human (GRCh38) Human (GRCh38)
Location 4:118346038-118346060 4:118346058-118346080
Sequence CCAGAAAGGTTTCCTTGTTTCAA CAAAAGGACATTCCTGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 14, 4: 248} {0: 1, 1: 0, 2: 1, 3: 28, 4: 229}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!