ID: 979238110_979238117

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 979238110 979238117
Species Human (GRCh38) Human (GRCh38)
Location 4:118424247-118424269 4:118424285-118424307
Sequence CCAAGATGGCAGTGTGGAGCCAT CGCACCCAGCAGTCGGCTGTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!