ID: 979270676_979270677

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 979270676 979270677
Species Human (GRCh38) Human (GRCh38)
Location 4:118756991-118757013 4:118757019-118757041
Sequence CCTGAAATTTGTTTTGGGCTGTG GTGTAACTTTATATTTCTTATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 8, 4: 207} {0: 1, 1: 4, 2: 4, 3: 34, 4: 342}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!