ID: 979281447_979281452

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 979281447 979281452
Species Human (GRCh38) Human (GRCh38)
Location 4:118872726-118872748 4:118872759-118872781
Sequence CCTTCATGAGATCCAAGAACTCT CTGGATCATACCCCTTTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 54, 4: 211} {0: 1, 1: 0, 2: 0, 3: 16, 4: 355}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!