ID: 979317064_979317069

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 979317064 979317069
Species Human (GRCh38) Human (GRCh38)
Location 4:119277652-119277674 4:119277679-119277701
Sequence CCTGGTTGACTTTCTGTCTCGTT TGTCTAATGTTGACAGTGGGGGG
Strand - +
Off-target summary {0: 3, 1: 1734, 2: 2403, 3: 2789, 4: 3149} {0: 11, 1: 5, 2: 18, 3: 21, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!