|
Left Crispr |
Right Crispr |
Crispr ID |
979317064 |
979317069 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
4:119277652-119277674
|
4:119277679-119277701
|
Sequence |
CCTGGTTGACTTTCTGTCTCGTT |
TGTCTAATGTTGACAGTGGGGGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 1734, 2: 2403, 3: 2789, 4: 3149} |
{0: 11, 1: 5, 2: 18, 3: 21, 4: 156} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|