ID: 979468714_979468725

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 979468714 979468725
Species Human (GRCh38) Human (GRCh38)
Location 4:121071338-121071360 4:121071379-121071401
Sequence CCTACCACGCAGAGGACAAATGA GGTCGGGCCAACCGAACTCCCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 1, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!