ID: 979495646_979495652

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 979495646 979495652
Species Human (GRCh38) Human (GRCh38)
Location 4:121380012-121380034 4:121380030-121380052
Sequence CCAACCTATGTCTCTAAGCCACA CCACAAGGAGGAAGCACTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 128} {0: 1, 1: 0, 2: 2, 3: 24, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!