ID: 979546461_979546474

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 979546461 979546474
Species Human (GRCh38) Human (GRCh38)
Location 4:121945668-121945690 4:121945719-121945741
Sequence CCCACCTGCTAATTGATATGGTT GAGATAGGATATGGAATCTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 132} {0: 1, 1: 0, 2: 2, 3: 10, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!